CIViC Evidence Items
660 evidence items indexed
Evidence Level Distribution
CIViC evidence levels reflect study design quality, from A (strongest) to E (weakest).
AValidated — meta-analysis, systematic review, or major guideline
BClinical — prospective trial or retrospective cohort study
CCase study — single case report or small case series
DPreclinical — in vitro or animal model data
EInferential — computational prediction or biological rationale
Gene × Evidence Type
Count of CIViC evidence items per gene and evidence type category. Hover a column header for the type definition.
| Predictive | Diagnostic | Prognostic | Functional | Predispos. | Oncogenic | |
|---|---|---|---|---|---|---|
| BCR::ABL1 | 323 | 11 | ||||
| BRAF | 186 | 4 | 26 | 2 | 1 | |
| EGFR | 248 | 12 | 3 | 2 | ||
| EML4::ALK | 64 | |||||
| ERBB2 | 142 | 2 | ||||
| FLT3 | 55 | 2 | 21 | |||
| KIT | 102 | 3 | 7 | |||
| KRAS | 159 | 4 | 24 | 4 | ||
| PIK3CA | 156 | 16 | 4 | |||
| PTEN | 53 | 1 | 3 | 1 | 2 | 1 |
| TP53 | 52 | 40 | 100 | 2 | ||
| VHL | 5 | 2 | 3 | 635 | 15 |
Predictive:Links a variant to treatment response or resistance
Diagnostic:Supports or refutes a specific disease diagnosis
Prognostic:Informs disease progression or clinical outcome
Functional:Characterises the biological effect of a variant
Predisposing:Germline variant associated with cancer predisposition
Oncogenic:Characterises the variant's role in oncogenesis
| Level | Gene | Variant | Type | Direction | Significance | Disease | Drugs | Source |
|---|---|---|---|---|---|---|---|---|
| C | VHL | C162Y (c.485G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | W88FS (c.263_265delGGCinsTT) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | K159fs (c.477_478insCA) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | S111R (c.333C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | S65L (c.194C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | Q73FS (c.217delC) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | A149fs (c.445delG) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | P81S (c.241C>T) and L188V (c.562C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Weirich et al., 2002 | |
| C | VHL | S65W (c.194C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Jilg et al., 2012 | |
| C | VHL | L158fs (c.471dupT) | Predisposing | N/A | Von Hippel-Lindau Disease | Zbar et al., 1996 | ||
| C | VHL | V66del (c.197_220del) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Olschwang et al., 1998 | |
| C | VHL | F76del (c.227_229del) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Olschwang et al., 1998 | |
| C | VHL | V84M (c.250G>A) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Eisenhofer et al., 2012 | |
| C | VHL | I151T (c.452T>C) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Gläsker et al., 1999 | |
| C | VHL | E94FS (c.279delC) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Moore et al., 2000 | |
| C | VHL | Splice Site (c.464-2A>G) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | G114dup (c.342dupGGT) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | Splice Site (c.341-2A>C) | Predisposing | Supports | Uncertain Significance | Renal Cell Carcinoma | Ong et al., 2007 | |
| C | VHL | Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | Splice Site (c.464-1G>C) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | Exon 3 Deletion | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | R161= (c.481C>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | R167W (c.499C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | E94* (c.280G>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | H115R (c.344A>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | I151F (c.451A>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | L178R (c.533T>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | P86S (c.256C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | 3'UTR alteration (c.*70C>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Wu et al., 2012 | |
| C | VHL | E70K (c.208G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Park et al., 2015 | |
| C | VHL | Q145* (c.433C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Sidhu et al., 2015 | |
| C | VHL | N150S (c.449A>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Sidhu et al., 2015 | |
| C | VHL | V84L (c.250G>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Huff et al., 2014 | |
| C | VHL | Y98H (c.292T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Luchetti et al., 2015 | |
| C | VHL | Splice Site (c.464-2A>G) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Glavac et al., 1996 | |
| C | VHL | R177ins (c.531insCTGAGAGTAAAGCCTGAA) | Predisposing | N/A | Von Hippel-Lindau Disease | Olschwang et al., 1998 | ||
| C | VHL | G144E (c.431G>A) | Predisposing | Supports | Uncertain Significance | Adrenal Gland Pheochromocytoma | van der Harst et al., 1998 | |
| C | VHL | Splice Region (c.463+8C>T) | Predisposing | Supports | Uncertain Significance | Adrenal Gland Pheochromocytoma | van der Harst et al., 1998 | |
| C | VHL | G104A (c.311G>C) | Predisposing | N/A | Von Hippel-Lindau Disease | Olschwang et al., 1998 | ||
| C | VHL | F91L (c.273C>G) | Predisposing | N/A | Von Hippel-Lindau Disease | Olschwang et al., 1998 | ||
| C | VHL | L184P (c.551T>C) | Diagnostic | Supports | Positive | Clear Cell Renal Cell Carcinoma | Gallou et al., 2001 | |
| C | VHL | R161* (c.481C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Şahin Atik et al., 2017 | |
| C | VHL | Exon 3 Deletion | Predisposing | N/A | Von Hippel-Lindau Disease | Allasia et al., 2017 | ||
| C | VHL | N78S (c.233A>G) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Kobayashi et al., 2016 | |
| C | VHL | c.128-?_250+? | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Lee et al., 2005 | |
| C | VHL | Y112H (c.334T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Chen et al., 1995 | |
| C | VHL | E70K (c.208G>A) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Kruizinga et al., 2014 | |
| C | VHL | V66Gfs*89 (c.197_209del) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Bausch et al., 2016 | |
| C | VHL | F76del (c.227_229del) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Bausch et al., 2016 | |
| C | VHL | N78S (c.233A>G) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Bausch et al., 2016 |