CIViC Evidence Items
4766 evidence items indexed
Evidence Level Distribution
CIViC evidence levels reflect study design quality, from A (strongest) to E (weakest).
AValidated — meta-analysis, systematic review, or major guideline
BClinical — prospective trial or retrospective cohort study
CCase study — single case report or small case series
DPreclinical — in vitro or animal model data
EInferential — computational prediction or biological rationale
Gene × Evidence Type
Count of CIViC evidence items per gene and evidence type category. Hover a column header for the type definition.
| Predictive | Diagnostic | Prognostic | Functional | Predispos. | Oncogenic | |
|---|---|---|---|---|---|---|
| BCR::ABL1 | 323 | 11 | ||||
| BRAF | 186 | 4 | 26 | 2 | 1 | |
| EGFR | 248 | 12 | 3 | 2 | ||
| EML4::ALK | 64 | |||||
| ERBB2 | 142 | 2 | ||||
| FLT3 | 55 | 2 | 21 | |||
| KIT | 102 | 3 | 7 | |||
| KRAS | 159 | 4 | 24 | 4 | ||
| PIK3CA | 156 | 16 | 4 | |||
| PTEN | 53 | 1 | 3 | 1 | 2 | 1 |
| TP53 | 52 | 40 | 100 | 2 | ||
| VHL | 5 | 2 | 3 | 635 | 15 |
Predictive:Links a variant to treatment response or resistance
Diagnostic:Supports or refutes a specific disease diagnosis
Prognostic:Informs disease progression or clinical outcome
Functional:Characterises the biological effect of a variant
Predisposing:Germline variant associated with cancer predisposition
Oncogenic:Characterises the variant's role in oncogenesis
| Level | Gene | Variant | Type | Direction | Significance | Disease | Drugs | Source |
|---|---|---|---|---|---|---|---|---|
| C | VHL | N131K (c.393C>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | Q132* (c.394C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | N150fs (c.445_458del) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | I151M (c.453C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | P154L (c.461C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | Splice Site (c.464-2A>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | Y156C (c.467A>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | L158V (c.472C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | E160fs (c.479_480delAG) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | R161Q (c.482G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | L163H (c.488T>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | R167Q (c.500G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | L178P (c.533T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | S183* (c.548C>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | Q195* (c.583C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | L198Q (c.593T>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Erlic et al., 2010 | |
| C | VHL | Y98H (c.292T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | Y112H (c.334T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | G114R (c.340G>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | L118P (c.353T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | L128F (c.382C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | L129P (c.386T>C) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | F136C (c.407T>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | R161Q (c.482G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | C162fs (c.483del) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | R167W (c.499C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | R167Q (c.500G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Benhammou et al., 2010 | |
| C | VHL | R167Q (c.500G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | N78I (c.233A>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | N78S (c.233A>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | C162Y (c.485G>A) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | W88FS (c.263_265delGGCinsTT) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | K159fs (c.477_478insCA) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | S111R (c.333C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | S65L (c.194C>T) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | Q73FS (c.217delC) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | A149fs (c.445delG) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Cybulski et al., 2002 | |
| C | VHL | P81S (c.241C>T) and L188V (c.562C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Weirich et al., 2002 | |
| C | VHL | S65W (c.194C>G) | Predisposing | Supports | Predisposition | Von Hippel-Lindau Disease | Jilg et al., 2012 | |
| C | VHL | L158fs (c.471dupT) | Predisposing | N/A | Von Hippel-Lindau Disease | Zbar et al., 1996 | ||
| C | VHL | V66del (c.197_220del) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Olschwang et al., 1998 | |
| C | VHL | F76del (c.227_229del) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Olschwang et al., 1998 | |
| C | VHL | V84M (c.250G>A) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Eisenhofer et al., 2012 | |
| C | VHL | I151T (c.452T>C) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Gläsker et al., 1999 | |
| C | VHL | E94FS (c.279delC) | Predisposing | Supports | Uncertain Significance | Von Hippel-Lindau Disease | Moore et al., 2000 | |
| C | VHL | Splice Site (c.464-2A>G) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | G114dup (c.342dupGGT) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | Splice Site (c.341-2A>C) | Predisposing | Supports | Uncertain Significance | Renal Cell Carcinoma | Ong et al., 2007 | |
| C | VHL | Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 | ||
| C | VHL | Splice Site (c.464-1G>C) | Predisposing | N/A | Von Hippel-Lindau Disease | Ong et al., 2007 |